?- so GABA signaling appears earlier than the

?- Aminobutyric acid (GABA) is the main inhibitory neurotransmitter in the mature central nervous system that reduces the neuronal
excitability. GABA receptors are divided in two sorts, GABAA and GABAB.
GABAA is an ionotropic receptor which mediates fast GABA responses
by opening the Cl¯ channel while metabotropic GABAB receptor causes
slower GABA responses via G-proteins and secondary messengers (Couve,
Moss et al. 2000, Bettler and Tiao 2006, Bowery 2006, Kornau 2006, Ulrich and Bettler 2007).

Excitatory
neurotransmitters depolarize the membrane by increasing the cation conductance;
whereas inhibitory neurotransmitters increase the anion conductance, resulting
in neuronal hyperpolarization (Coull, Beggs et al.
2005). The GABAA receptors have Cl¯ channel (Cutler and Cramb
2002). It allows the influx of Cl¯, based on ion gradient, leads to hyperpolarization.
This transition takes place using ion transporter so if the Cl¯ transporters are
down regulated, Cl¯ gradient
decreases and the opening of GABAA receptors may result in the efflux
of these anions, leading to depolarization of the membrane. In this way, GABA
receptor triggers excitation instead of the inhibition (Coull, Beggs et al.
2005, Galanopoulou 2008). It is similar to what happen during early development, that GABA
confers excitation (Ben-Ari, Gaiarsa et
al. 2007). It has been demonstrated that the GABAergic neurons mature faster than the
glutamatergic so GABA signaling appears earlier than the glutamatergic
transmission. Thus, GABA is the major excitatory neurotransmitter before the
maturation of glutamatergic synapses (Tyzio, Represa et
al. 1999, Khazipov, Esclapez et al. 2001, Ben-Ari, Gaiarsa
et al. 2007). In this period, GABA activates
calcium sensitive signaling processes that are necessary for neuronal
differentiation and brain development (Galanopoulou 2008). These effects have also reported for GABAB
receptors that could regulate the neuronal development by modulating of
intracellular calcium in hippocampal cells (López?Bendito,
Shigemoto et al. 2004). Given GABA receptors play an important role in neuronal
plasticity underlying learning and memory (Benke 2010).

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

Hippocampus
is a key region
for learning and memory which involves
in memory consolidation that GABAergic neurons in the septo-hippocampal system are
involved in memory processes (Dalrymple-Alford 1994, Izquierdo and Medina 1995).

Structurally, GABAA receptors are heteropentameric transmembrane receptors
consisting of several subunits from families ?, ?, ?, ?, ?, ? and
? (Mehta and Ticku 1999). In the hippocampus the principal
subunits are ?1, ?2, ?5, ?3, ?2 that mostly consist of two ?, two ? and one ? which arranged around a central
canal. Particularly, ? subunit plays an important role in determining the affinity for GABA (Barnard, Skolnick et al. 1998). GABAB receptors are
metabotropic receptors that consist of two subunits, GABAB1 and GABAB2
(López?Bendito,
Shigemoto et al. 2004). It has stated that GABAB1
is required in all functional GABAB receptors (Pagano, Rovelli et al. 2001, Prosser, Gill et al. 2001) so that inactivated GABAB1
gene removes the GABAB responses, so GABAB1 is a
necessary component of GABAB receptors (Prosser, Gill et al. 2001, Schuler, Lüscher et al. 2001).

Accordingly, we hypothesized that expression of
GABA receptors which begins at the embryonic
day in rats (Lauder, Han et al. 1986, Haydar,
Wang et al. 2000),  is high in the first two postnatal weeks, because the existing evidence demonstrated that the first
postnatal weeks in rats, is a very active period for hippocampal neurogenesis (Humphrey
1967, Rice and Barone Jr
2000, Ge, Shi et al. 2015). Thus, the aim of present study was to investigate the
development of GABAA?1
and GABAB1 receptor
subunits in the developing rat hippocampus at P0, P7 and P14. Evaluation
was conducted as molecular (real-time PCR and western blot) and immunohistochemically.

 

Materials and Methods

Animals

Female
adult Wistar rats (200–250g body weight and 6-8 weeks) were purchased from
Mashhad University of Medical Silence, Mashhad, Iran. Rats were transferred to animal laboratory
at least 10 days before experiment, for adaptability to environment. Procedures involving animals were in accordance with the animal care guidelines in the animal laboratory of Mashhad
University of medical science. Animals were housed under
controlled conditions (21–24°C and 12 hours light/darkness cycle with natural
light) in individual cages and received
standard pellet with tap water ad libitum. Animals were mated with male rats overnight.
After verification of pregnancy with vaginal smear, male rat separated from them
and that day was considered as the first day of pregnancy.  

Tissues preparation

At the end of the pregnancy and natural delivery, birthday defined as postnatal day
0 (P0). Male offspring
rats were randomly divided to 3 age groups (n = 6), P0, P7
and P14. After ending of the respective period for each offspring, neonates were anesthetized with chloroform and killed by
cervical dislocation. In the
following, their skull was opened. To assess the expression of GABAA?1
and GABAB1 receptors in the mRNA level was performed the quantitative
real-time PCR and Western blot analysis for protein. For these assessments,
hippocampi were carefully dissected. Whole brain removed to study of distribution pattern of these receptors by immunohistochemistry.

Total RNA extraction and cDNA synthesis

Offspring’s
dissected hippocampi with added RNA later (Behnogen, Tehran, Iran) stored at
-70 ? C until further analysis. Total RNA was isolated by Total RNA
extraction kit (Pars Tous, Mashhad, Iran) according to the
manufacturer’s instructions. To determinate the purity
and concentration was used from spectrophotometer.
RNA extraction was checked by 1.5% agarose gel electrophoresis by visualization
of 18S and 28S ribosomal bands. To eliminate the
genomic DNA from RNA preparation was used from DNase treatment kit (Pars
Tous, Mashhad, Iran). After cDNA synthesis from total
RNA with especial kit and protocol (Pars Tous, Mashhad, Iran) then obtained product were stored at -20 ? C.

Quantitative real-time PCR

The sequences of primer sets were obtained from the NCBI database and
checked for specificity using the NCBI BLAST tool. The using primers were: 50- TGTCTTTGGAGTGACGACCG -30 (forward) and
50- CATCCCACGCATACCCTCTC -30 (reverse) for GABAA?1, 50- TGCACCGAACCATTGAGACT -30 (forward) and 50- AGAAAATGCCAAGCCACGTA -30 (reverse) for GABAB1, and 5?-TAT CGG CAA TGA GCG GTTCC-3?(forward) and 5?-AGC ACT GTG TTG GCA TAGAGG-3?
(reverse) for ?-Actin. The primers were produced by Macrogen company (Seoul,
Korea).

Final
mixture of PCR was composed
of 1 µL cDNA, 1 µM forward primer, 1 µM reverse primer, 6.6 µL sterilized water, and 10
µL SYBR green premix (TaKaRa, Biotechnology Co., China). PCR parameters were 94ºc for 10
min to activate of enzymes and 40 cycles (15 s at 95ºc and 1 min at 60ºc) and 2
steps. After running, melting curves were obtained to ensure of no primer-dimmer
artifacts. To measure the relative quantitation of the mRNA expression, ?-Actin
was used as internal control.

Western blot analysis

Expression of GABAA?1 and GABAB1 receptor
proteins in newborn’s hippocampi was measured by western blot analysis. The
samples were homogenized with lysis buffer (50 mM/L Tris-Hcl, 150 mM/L NaCl, 1 mM/L
EDTA, 0.5 ml Triton X-100, pH 7.4) containing protease inhibitor cocktail
tablet (Roche, Germany). To
determine the protein concentration was used the Bradford protein microassay method.
Equal amount of total protein sample (50 µg) were separated on 7.5% sodium dodecyl sulfate–polyacrylamide
gels (SDS–PAGE) and transferred onto
polyvinylidene difluoride (PVDF) membranes (Millipore, USA). The
blocking of membrane was done with 5% skimmed milk (Sigma-Aldrich, USA). After blocking, membranes were incubated in rabbit
anti-GABAA?1R antibody (dilution 1:100,
Biorbyt, San
Francisco); rabbit anti-GABAB1R
antibody (dilution 1:100, Biorbyt, San Francisco), and rabbit anti- ?-Actin
antibody (dilution 1:100, Biorbyt, San Francisco). Afterward, were washed for 4 times with 0.1% tween 20 in
PBS and incubated with
secondary antibody, HRP-conjugated goat anti-rabbit IgG
(dilution 1:1000, Abcam, USA). The GABAA?1 and GABAB1 protein bands were visualized using enhanced
chemiluminescnces (ECL) method (Bioimaging, system, syngene, UK). Densitometric assessment of obtained gel pictures was measured by
ImageJ software. ?-Actin was selected as internal control for normalization.

Immunohistochemistry

To investigate the distribution pattern of GABAA?1 and
GABAB1 receptors was performed immunohistochemistry. Horizontal brain
sections were deparaf?nized with xylene, rehydrated through descending
concentrations of ethanol, and rinsed in 0.1 M phosphate-buffered saline (PBS)
for 10 min. Antigen retrieval was done in PBS at 100 ºc for 15 min.
samples were incubated in BSA mixture (0.01 g BSA, 10 µl Triton X and 1000 µl
PBS) at room temperature. For blocking the endogenous peroxides activity, the
slides were incubated in 3% H2O2-PBS for 15 min at room temperature,
washed three times with PBS, incubated in 10 % normal goat serum for 20 min in PBS.
Afterwards, sections were incubated in primary antibody, rabbit anti-GABAA?1R antibody (dilution 1:100, Biorbyt, San Francisco);
rabbit anti-GABAB1R antibody (dilution 1:100, Biorbyt, San Francisco),
overnight at 4oC. After three washing of samples with PBS, were
incubated with secondary antibody, HRP-conjugated goat anti-rabbit IgG (dilution 1:1000, Abcam, USA)
dissolved in 0.02 g BSA, 20 µl Triton X and 2 cc PBS for 1 h at room
temperature. After three washing in PBS, the slides were reacted with 0.05 % diaminobenzidine
(DAB; Sigma-Aldrich, USA) solution and 0.01 % H2O2 for
10–15 min at room temperature in dark. In the
following, counterstaining of samples was done with Mayer’s hematoxylin. After
dehydration with Ethanol and clearing with xylene, the slides were mounted with coverslip.

x

Hi!
I'm Simon!

Would you like to get a custom essay? How about receiving a customized one?

Check it out